View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14185_low_15 (Length: 243)
Name: NF14185_low_15
Description: NF14185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14185_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 226
Target Start/End: Original strand, 50242880 - 50243094
Alignment:
| Q |
12 |
gagcagagagagactccttgctaaaaaaggataccctgatgatgatttcaactataatgattccgctcctaaacgcagttgtttcgatcttgatgctctt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
50242880 |
gagcagagagagactccttgctaaaaaaggataccctgatgatgatttcaactataatgattccgctcccaaacgcagttgttttgatcttgatgctctt |
50242979 |
T |
|
| Q |
112 |
tctgaacgcgttgtcaacatccgcaatgtctttcgtgatttcattggaaaactctacgagatgggtcgttctgatcgacgtagagttgtttttgccatga |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50242980 |
tctgaacgcgttgtcaacattcgcaatgtctttcgtgatttcattggaaaactctacgagatgggtcgttctgatcgacgtagagttgtttttgccatga |
50243079 |
T |
|
| Q |
212 |
aagctggtttaagtt |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
50243080 |
aagctggtttaagtt |
50243094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University