View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14185_low_9 (Length: 306)
Name: NF14185_low_9
Description: NF14185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14185_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 7 - 288
Target Start/End: Complemental strand, 11283029 - 11282748
Alignment:
| Q |
7 |
gaagaatatacaattaaccatataaatatataaattaacctgttcaatgtctctttcaacggtaccaattctattcagatccgaagtagttgaagtagtt |
106 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11283029 |
gaagaatatacaattaaccatataaattaacgaatatacctgttcaatgtctctttcaacggtaccaattctattcagatccgaagtagttgaagtagtt |
11282930 |
T |
|
| Q |
107 |
gtcgtcatcataaccgtatcagaccgtgacatccctcaatctaagaacaagaaatcacttctcaactattaccaaaaattcaaacaccaatatcttcaac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11282929 |
gtcgtcatcataaccgtatcagaccgtgacatccctcaatctaagaacaagaaatcacttctcaactattacgaaaaattcaaacaccaatatcttcaac |
11282830 |
T |
|
| Q |
207 |
tcattcacccattctcatacccaaacccttccattcaccccccgaaaacccttccaaaacccaaatcactacgctaaattct |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11282829 |
tcattcacccattctcatacccaaacccttccattcaccccccgaaaacccttccaaaacccaaatcactgcgctaaattct |
11282748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University