View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14186_high_10 (Length: 217)
Name: NF14186_high_10
Description: NF14186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14186_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 194
Target Start/End: Original strand, 13859296 - 13859469
Alignment:
| Q |
21 |
gatttggatcccttaatgtggccagattcaagatggaaaaacatcgaggttaagtgggacaagccagattgtgggggaaaacccaatagaatttgttctt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13859296 |
gatttggatcccttaatgtggccagattcaagatggaaaaacatcgaggttaagtgggacaagccagattgtgggggaaaacccaatagagtttgttctt |
13859395 |
T |
 |
| Q |
121 |
gggacattcttttatcctcccggtcttcggcatcaagttctaaaaggccgttacaatctggattgtctggtata |
194 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13859396 |
gggacattcttttatcctcccggtctttggcatcaagttctaaaaggccgttacaatctagattgtctggtata |
13859469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University