View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14189_low_6 (Length: 264)
Name: NF14189_low_6
Description: NF14189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14189_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 41630163 - 41630407
Alignment:
| Q |
1 |
tcgaaggtgaagttattgaaacgaattcgtgggaagcatttatgcgaaaattgtgggaaaacatttcgatcttctagagcattgggaagtcatagaagta |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630163 |
tcgaaggtgaagttattgaaacgagttcgtgggaagcatttatgcgaaaattgtgggaaaacatttcgatcttctagagcattgggaagtcatagaagta |
41630262 |
T |
 |
| Q |
101 |
tttgttgtcgcgatgaagcgaagaagaatggtaatggtaacgatgataagatttttgaatgtccattttgttttaaggtttttggttctggtcaagcact |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630263 |
tttgttgtcgcgatgaagcgaag---aatggtaatggtaacgatgataagatttttgaatgtccattttgttttaaggtttttggttctggtcaagcact |
41630359 |
T |
 |
| Q |
201 |
tggtggtcacaagagatctcatctcatgatcccttcttcatcaacttc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41630360 |
tggtggtcacaagagatctcatctcatgatcccttcttcatcaacttc |
41630407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University