View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1418_high_16 (Length: 247)
Name: NF1418_high_16
Description: NF1418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1418_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 8456475 - 8456258
Alignment:
| Q |
13 |
atgaagaggcatgaatttgtaatttatccacccaacaacaggccagaactgcagttcaattcaatggagatctttcttaaagtcagaaacaatataaacc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8456475 |
atgaagaggcatgaatttgtaatttatccacccaacaacaggccagaactgcagttcaattcaatggaggtctttcttaaagtcagaaacaatataaacc |
8456376 |
T |
 |
| Q |
113 |
aattcttgaagtaaattctgtttgatattacaattgtactacaagattaccgtccatgatgctttctgcactgatggataacccttcttcactctagctt |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8456375 |
aattcttgaagtaaattttgtttgatattacaattgtactacaagattaccgtccatgatgctttctgcactgatggataacccttcttcactctagctt |
8456276 |
T |
 |
| Q |
213 |
tcacgttgacccaaggtt |
230 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
8456275 |
tcacattgacccaaggtt |
8456258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University