View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1418_high_17 (Length: 246)
Name: NF1418_high_17
Description: NF1418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1418_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 11138240 - 11138014
Alignment:
| Q |
1 |
gttaaaaattgacttgctatggtaagattatttcagtttaacacctccctctatggtaagtttatttgagattttatgcaacatatataagtctaacaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
11138240 |
gttaaaaattgacttgctatggtaagattatttcagtctaacacctccctctatggtaagtttatttgagatgttatgcaacata----agtctaacaaa |
11138145 |
T |
 |
| Q |
101 |
atgtggatccatatgttcattcacaaacaagtatgcaagaaaaccaaatttcatggacacagagagtgttgcaggatcctgttttcggaactcaagtttc |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11138144 |
ttgtggatccaaatgttcattcacaaacaagtatgcaagaaaaccaaatttcatggacacagagagtgttgcaggatcctgtttttggaactcaagtttc |
11138045 |
T |
 |
| Q |
201 |
aaagtcaaagaagttt-taaaacatggtttc |
230 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
11138044 |
aaagtcaaagaagtttctaaaacatggtttc |
11138014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University