View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1418_high_19 (Length: 239)
Name: NF1418_high_19
Description: NF1418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1418_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 73 - 221
Target Start/End: Complemental strand, 33782360 - 33782212
Alignment:
| Q |
73 |
ctactcctaaaactagataatgtttgtgaccacaaataaaagactaacgacaaagagaaacattnnnnnnnncaatttgcttcacaaacgaagggtgagg |
172 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33782360 |
ctactactaaaactagataatgtttgtgaccacaaataaaagactaacgacaaagagaaacattaaaaaaaacaatttgcttcacaaacgaagggtgagg |
33782261 |
T |
 |
| Q |
173 |
tcaagattggcatgatcagaaggttcagcaggaggaggagtatcgtatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33782260 |
tcaagattggcatgatcagaaggttcagcaggaggaggagtatcgtatt |
33782212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 64
Target Start/End: Complemental strand, 33782431 - 33782384
Alignment:
| Q |
17 |
agaagagagagacctcctttttcgttgtaatatcatgatggtcaacat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33782431 |
agaagagagagacctcctttttcgttgtaatatcatgatggtcaacat |
33782384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University