View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1418_low_15 (Length: 249)
Name: NF1418_low_15
Description: NF1418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1418_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 66 - 230
Target Start/End: Original strand, 47340273 - 47340435
Alignment:
| Q |
66 |
tcgtcattagtgtattaacaccttggttatcatcagattcagtgttatgttggtcaatttacatgatcgctgtgacgagtattggagctattctaataga |
165 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47340273 |
tcgtcattagtgtattaacacct-ggttatcatcagattcagtgttatgttggtcaatttacatgatcgctgtgacgagtattggagctattctaataga |
47340371 |
T |
|
| Q |
166 |
tactccaaaaccgattagaatatgtttaattttattctatttattttcaataaagtcataacatt |
230 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47340372 |
tactccaaaactgattagaatatgtttaattttattcta-ttattttcaataaagtcataacatt |
47340435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University