View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1418_low_4 (Length: 412)
Name: NF1418_low_4
Description: NF1418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1418_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 38891251 - 38891494
Alignment:
| Q |
13 |
aatataagaatgatagaaacagtttgtcagatcatagatatgtccaatcccatccatcgaactgataagtttctttgcacagcaagaggcgtgaagtact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38891251 |
aatataagaatgatagaaacagtttgtcagatcatagatatgtccaatcccatccatcgaactgataagtttctttgcacagcaagaggcgtgaagtact |
38891350 |
T |
 |
| Q |
113 |
accaaaaggtcttgatggggctactatactatactttgcttttgaggatca----ggatcagattcagaagcaatagcaatagcaatagcaatagcaaag |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38891351 |
accaaaagctcttgatggggctactatactatactttgcttttgaggatcaggatggatcagattcagaagcaatagcaatagcaatagcaatagcaaag |
38891450 |
T |
 |
| Q |
209 |
ctagtttgatcattagtcatacactagttgttcattcatttcag |
252 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38891451 |
ctagtttgatcattagtcatgcactagttgttcattcatttcag |
38891494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 300 - 412
Target Start/End: Original strand, 38891531 - 38891643
Alignment:
| Q |
300 |
aaagaaaataatacttgttaattctgactattcctttcttctttgtatgagtcataatattctctttctcttaccttattggcttttgtttggttttgtt |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38891531 |
aaagaaaataatacttgttaattctgactattcctttcttctttgtatgagtcataatattctctttctcttaccttattggcttttgtttggttttgtt |
38891630 |
T |
 |
| Q |
400 |
aagggaaacaaat |
412 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38891631 |
aagggaaacaaat |
38891643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University