View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1418_low_8 (Length: 367)
Name: NF1418_low_8
Description: NF1418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1418_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 20 - 217
Target Start/End: Original strand, 30214416 - 30214613
Alignment:
| Q |
20 |
ttaaaaatgctcaatgatttttatttcaagagtctatcatctttttgcaaattaaactagttggggtctaaacatttggcaacagataacatccttacgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30214416 |
ttaaaaatgctcaatgatttttattttaagagtctatcatctttttgcaaattaaactagttggggtctaaacatttggcaacagataacatccttatgg |
30214515 |
T |
|
| Q |
120 |
gtagcagtattagtcacattaattgttaattgcgattgtggcagcaggagcacatttggacatttgcacactcaaccctattaattaaattcagacat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30214516 |
gtagcagtattagtcacattaattgttaattgcgattgtggcagcaggagcacatttggacatttgcacactcaactctattaattaaattcagacat |
30214613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 217 - 354
Target Start/End: Original strand, 30214638 - 30214775
Alignment:
| Q |
217 |
ttttttctcagttttgaacttttctgtgacgtaaaatgcaccaaatgaatgatcttacaattaattcaagttgaatattgtgtctacattcaatgacaac |
316 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
30214638 |
ttttctctcagttttgaacttttctgtgacgtaaaatgcaccaaatcaatgatcttacaattaattccagttgaatattgtgtctgcattcaatgacaac |
30214737 |
T |
|
| Q |
317 |
tatacatacatagcttcagtcagccccttcgtccgttc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30214738 |
tatacatacatagcttcagtcagccccttcgtccgttc |
30214775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University