View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14190_high_2 (Length: 206)
Name: NF14190_high_2
Description: NF14190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14190_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 188
Target Start/End: Complemental strand, 51423981 - 51423806
Alignment:
| Q |
13 |
agcagagagcacagttttgttcaacaaaggtctagcatgtggtgcatgttatgaaatcagatgtgtggactctcctcaagggtgtaagccagagcaagcc |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51423981 |
agcagtgagcacagttttgttcaacaaaggtctagcatgtggtgcatgttatgaaatcagatgtgtggactctcctcaagggtgtaagccagggcaagcc |
51423882 |
T |
 |
| Q |
113 |
tctattaaagtgacggcaacagacctttgtcctcccaattttgcccaatcaagtgagaatggaggatggtgcaacc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51423881 |
tctattaaagtgacggcaacagacctttgtcctcccaattttgcccaatcaagtgagaatggaggatggtgcaacc |
51423806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University