View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14191_high_21 (Length: 261)
Name: NF14191_high_21
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14191_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 76 - 191
Target Start/End: Original strand, 46633396 - 46633511
Alignment:
| Q |
76 |
ggaaattgagatactgtaaatctatcaagacttttatggttgaacccgatgaagaaaacatatcattttgcgatagttctactggtttgtctcatccatt |
175 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46633396 |
ggaaattgagatactataaatctatcaagacttttatgtttgaacccgatgaagaaaacatatcattttgcgatagttctactggtttgtctcatccatt |
46633495 |
T |
 |
| Q |
176 |
atcatgtttgtgatca |
191 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46633496 |
atcatgtttgtgatca |
46633511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 46633352 - 46633402
Alignment:
| Q |
1 |
atgtaaaatatcaaaaatcttagaagattggtaagtatcacaagggaaatt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46633352 |
atgtaaaatatcaaaaatcttagaagattggtaagtatcacaagggaaatt |
46633402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University