View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14191_high_25 (Length: 242)
Name: NF14191_high_25
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14191_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 12511030 - 12510808
Alignment:
| Q |
18 |
tcaataatgagttcgcatgtagttagtgttgtggctcaatattttgcttctctacatgaccttgcaatcacatcttgtttattgccattccataaattca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12511030 |
tcaataatgagttcgcatgtagttagtgttgtggctcaatattt-gcttctctacatgaccttgcaatcacatcttgtttattgccattccataaattca |
12510932 |
T |
|
| Q |
118 |
aatttcctcttaagagaacaaaatggcctaaggtagatctcctatgacaaggtgattctgttggacgaatcacattaattttgcaccttccaagtagcct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12510931 |
aatttcctcttaagagaacaaaatggcctaaggtagatctcctatgacaaggtgattctgttggacgaatcacattaattttgcaccttccaagtagcct |
12510832 |
T |
|
| Q |
218 |
agattctttgtaccagtagaataa |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
12510831 |
agattctttgtaccagtagaataa |
12510808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University