View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14191_high_31 (Length: 230)
Name: NF14191_high_31
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14191_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 31604797 - 31604599
Alignment:
| Q |
18 |
tattcaaggacaaacattcaacactcatgatgatcttaacacaaatatgaatttgacaatgaattggccatcttcaagtcatgttccatctctaccatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31604797 |
tattcaaggacaaacattcaacactcatgatgatcttaacacaaatatgaatttgacaatgaattggccatcttcaagtcatgttccatctctaccatgg |
31604698 |
T |
 |
| Q |
118 |
ccttctaacttgcttaatccaaataatatttcagtaaattcattacttctaaaagcattacaacttaggaattatcaacaacaaagagaagttgcagct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31604697 |
ccttctaacttgcttaatccaaataatatttcagtaaattcattacttctaaaagcattacaacttaggaattatcagcaacaaagagaagttgcagct |
31604599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University