View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14191_high_33 (Length: 212)
Name: NF14191_high_33
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14191_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 17 - 178
Target Start/End: Original strand, 30854126 - 30854288
Alignment:
| Q |
17 |
gatggttataaagattgaatttaatgatttatagaagnnnnnnnnctagttaaaacggtttctcatttgaaacacctttataattagagaagtgatattc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30854126 |
gatggttataaagattgaatttaatgatttatagaagaaaaaaaactagttaaaacggtttatcatttgaaacacctttataattagagaagtgatattc |
30854225 |
T |
 |
| Q |
117 |
gtgaaatcattttgtgacaacttttaga-cactctcttttatacactcatatgatattcttat |
178 |
Q |
| |
|
||||||| ||||||| |||||||||||| ||||||| |||||||||||||||||||| |||| |
|
|
| T |
30854226 |
gtgaaatgattttgtaacaacttttagataactctctcttatacactcatatgatatttttat |
30854288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University