View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14191_high_35 (Length: 206)
Name: NF14191_high_35
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14191_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 54985958 - 54986129
Alignment:
| Q |
19 |
aggatgctgaatctgtattttgtttgactgatcttatctacgtttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54985958 |
aggatgctgaatctgtattttgtttgactgatcttatctatgtttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatatt |
54986057 |
T |
|
| Q |
119 |
ctcaaagaagggaatgaaaggaatgtctgttagtggaatgaactactatgcttgtctctccatattatctct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54986058 |
ctcaaagaagggaatgaaaggaatgtctgttagtggaatgaactactatgcttgtctctccatattatctct |
54986129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 60 - 175
Target Start/End: Original strand, 7883510 - 7883625
Alignment:
| Q |
60 |
gtttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatattctcaaagaagggaatgaaaggaatgtctgttagtggaatga |
159 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||| |||| ||||| ||||||||||||||||||||||| |||||||| |||||| |||||||||||||| |
|
|
| T |
7883510 |
gtttcaggatttatgggagctatgatatcaaatttggcatttgtatttaggaatatattctcaaagaaaggaatgaatggaatgagtgttagtggaatga |
7883609 |
T |
|
| Q |
160 |
actactatgcttgtct |
175 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
7883610 |
actattatgcttgtct |
7883625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 62 - 173
Target Start/End: Original strand, 18396534 - 18396645
Alignment:
| Q |
62 |
ttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatattctcaaagaagggaatgaaaggaatgtctgttagtggaatgaac |
161 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| |||| |||||||| | || || ||||| || ||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
18396534 |
ttcaggttttatgggggctatgatatcaaatctggcatttgtgttccgcaacatcttctcgaaaaaggggatgaagggaaagtctgttagtggaatgaat |
18396633 |
T |
|
| Q |
162 |
tactatgcttgt |
173 |
Q |
| |
|
|||||||||||| |
|
|
| T |
18396634 |
tactatgcttgt |
18396645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University