View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14191_low_15 (Length: 324)
Name: NF14191_low_15
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14191_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 38 - 308
Target Start/End: Original strand, 28862513 - 28862783
Alignment:
| Q |
38 |
ttattaatatgagtcaaccaaccaataggataattagaaattagtgaaccctacgataagcccgtggtcagtcacacactgagttacatcccttcctcct |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28862513 |
ttattaatatgagtcaaccaaccaataggataattagaaattagtgaaccctacgataagcccgtggtcagtcacacactgagttacatcccttcctcct |
28862612 |
T |
 |
| Q |
138 |
tctcattcctcacttcctcccaatcccaaacacaattgtgtaaaatcaaacgcgatcgatcaaattagggtttcgaattttcgattctgaaattgtagaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28862613 |
tctcattcctcacttcctcccaatcccaaacacaattgtgtaaaatcaaacgcgattgatcaaattagggtttcgaattttcggttctgaaattgtagaa |
28862712 |
T |
 |
| Q |
238 |
caaaaatgggaggtggtggagcagatcacggtaatggcggagccaatggaggagatttcaggtacaaggtt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28862713 |
caaaaatgggaggtggtggagcagatcacggtaatggcggagccaatggaggagatttcaggtacaaggtt |
28862783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University