View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14191_low_23 (Length: 254)
Name: NF14191_low_23
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14191_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 782406 - 782645
Alignment:
| Q |
1 |
tatggattttgttgttgataaatcacgtttccggtgaaatcaaatctagttatatgtggattggttttaaaatccgattatagtaaatgcnnnnnnnatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
782406 |
tatggattttgttgttgataaatcacgtttccggtgaaatcaaatctagttat--gtggattggttttaaaatccgattatagtaaatgctttttttatg |
782503 |
T |
 |
| Q |
101 |
gatgtggactgattatatgatattctatccataagcaaccctacttgtcacatgtgcaatggagacttttgatttaaattcttgctttaaaatgcaactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
782504 |
gatgtggactgattatatgatattctatccataagcaaccctacttgtcacatgtgcaatggagactttagatttaaattcttgctttaaaatgcaactt |
782603 |
T |
 |
| Q |
201 |
ttttctggtcaacaatgttttactatctcattccccctttgc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782604 |
ttttctggtcaacaatgttttactatctcattccccctttgc |
782645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University