View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14191_low_36 (Length: 212)

Name: NF14191_low_36
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14191_low_36
NF14191_low_36
[»] chr7 (1 HSPs)
chr7 (17-178)||(30854126-30854288)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 17 - 178
Target Start/End: Original strand, 30854126 - 30854288
Alignment:
17 gatggttataaagattgaatttaatgatttatagaagnnnnnnnnctagttaaaacggtttctcatttgaaacacctttataattagagaagtgatattc 116  Q
    |||||||||||||||||||||||||||||||||||||        |||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
30854126 gatggttataaagattgaatttaatgatttatagaagaaaaaaaactagttaaaacggtttatcatttgaaacacctttataattagagaagtgatattc 30854225  T
117 gtgaaatcattttgtgacaacttttaga-cactctcttttatacactcatatgatattcttat 178  Q
    ||||||| ||||||| ||||||||||||  ||||||| |||||||||||||||||||| ||||    
30854226 gtgaaatgattttgtaacaacttttagataactctctcttatacactcatatgatatttttat 30854288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University