View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14191_low_37 (Length: 208)
Name: NF14191_low_37
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14191_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 5e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 60 - 190
Target Start/End: Original strand, 18479001 - 18479131
Alignment:
| Q |
60 |
aaagaatcattggaacactaacatcaagaaaagactcatcagaatggggatagatcccaccactcacaaaccaaaatccaacaacaacaatgataatgtt |
159 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
18479001 |
aaagaatcattggaacattaacatcaagaaaagactcatcagaatggggatagatcccaccactcacaaaccaaaatccaacaacaacaacgataatgat |
18479100 |
T |
 |
| Q |
160 |
aatactgctatcaaacacgtgtctcaatggg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18479101 |
aatactgctatcaaacacgtgtctcaatggg |
18479131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 18478937 - 18478981
Alignment:
| Q |
17 |
aatatgcactttacagatggtccacaatagcagctctcctgccaa |
61 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18478937 |
aatatgcacttcacagatggtccacaatagcagctctcctgccaa |
18478981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University