View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14191_low_39 (Length: 204)
Name: NF14191_low_39
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14191_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 112 - 194
Target Start/End: Complemental strand, 1560294 - 1560212
Alignment:
| Q |
112 |
ttttcctgggttttgatgatgaaggagatgaatgttgctggatttattgatgacgatgatgaatgttgctgggtttgatgatg |
194 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1560294 |
ttttcctgggttttgatgatgaaggtgatgaatgttactggatttattgatgaagatgatgaatgttgctgggtttgatgatg |
1560212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 122 - 194
Target Start/End: Original strand, 1561237 - 1561309
Alignment:
| Q |
122 |
ttttgatgatgaaggagatgaatgttgctggatttattgatgacgatgatgaatgttgctgggtttgatgatg |
194 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
1561237 |
ttttgatgatgaaggtgatgaatgttgctggatttattgatgaagatgataaatgttgctgggtatgatgatg |
1561309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 191
Target Start/End: Original strand, 42856444 - 42856514
Alignment:
| Q |
121 |
gttttgatgatgaaggagatgaatgttgctggatttattgatgacgatgatgaatgttgctgggtttgatg |
191 |
Q |
| |
|
||||||||||| || | ||||||| || ||| ||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
42856444 |
gttttgatgattaatgtgatgaatttttttgggtttattgatgaaaatgatgaatgttgttgggtttgatg |
42856514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 112 - 194
Target Start/End: Complemental strand, 2377154 - 2377072
Alignment:
| Q |
112 |
ttttcctgggttttgatgatgaaggagatgaatgttgctggatttattgatgacgatgatgaatgttgctgggtttgatgatg |
194 |
Q |
| |
|
||||||||| ||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2377154 |
ttttcctggattttgatgatgaaggtgataaatgttgctggatttattgatgaagatgatgaatgttgctgggtttgatgatg |
2377072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 121 - 194
Target Start/End: Complemental strand, 38119954 - 38119881
Alignment:
| Q |
121 |
gttttgatgatgaaggagatgaatgttgctggatttattgatgacgatgatgaatgttgctgggtttgatgatg |
194 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
38119954 |
gttttgatgatgaaggtgatgaatgttgctgggtttattgatgaagatgatgaatgttgttgggtttgatgatg |
38119881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 194
Target Start/End: Original strand, 2380181 - 2380254
Alignment:
| Q |
121 |
gttttgatgatgaaggagatgaatgttgctggatttattgatgacgatgatgaatgttgctgggtttgatgatg |
194 |
Q |
| |
|
|||||||| ||||||| ||||||| || || | | ||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
2380181 |
gttttgataatgaaggtgatgaatttttctaggtatattgatgaagatgatgaatgttgttggatttgatgatg |
2380254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 121 - 190
Target Start/End: Original strand, 33329414 - 33329483
Alignment:
| Q |
121 |
gttttgatgatgaaggagatgaatgttgctggatttattgatgacgatgatgaatgttgctgggtttgat |
190 |
Q |
| |
|
|||||||||||||| | ||||||| || ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33329414 |
gttttgatgatgaatgtgatgaatttttttggatttattgatgaaaatgatgaatgttgctgggtttgat |
33329483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 194
Target Start/End: Original strand, 8284799 - 8284871
Alignment:
| Q |
122 |
ttttgatgatgaaggagatgaatgttgctggatttattgatgacgatgatgaatgttgctgggtttgatgatg |
194 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||||||| ||||| ||| ||| |||||||||||||| |
|
|
| T |
8284799 |
tttttatgatgaaggtgatgaatgttgctgcatttattgatgaagatgacgaacattgttgggtttgatgatg |
8284871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 35237496 - 35237456
Alignment:
| Q |
154 |
tttattgatgacgatgatgaatgttgctgggtttgatgatg |
194 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||||| |
|
|
| T |
35237496 |
tttattaatgaagatgatgaatgttgctggatttgatgatg |
35237456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 106 - 147
Target Start/End: Original strand, 26273149 - 26273189
Alignment:
| Q |
106 |
gatgaattttcctgggttttgatgatgaaggagatgaatgtt |
147 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
26273149 |
gatgaattttcctgggttt-gatgatgaaggggatgaatgtt |
26273189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 194
Target Start/End: Complemental strand, 13324584 - 13324513
Alignment:
| Q |
122 |
ttttgatgatgaaggagatgaatgttgctggatttattgatgacgatgatgaatgttgctgggtttgatgatg |
194 |
Q |
| |
|
||||||||||||||| ||||||| || ||| ||||| ||||| |||||||||| || |||||||||||||| |
|
|
| T |
13324584 |
ttttgatgatgaaggtgatgaatttttatgggtttatggatgaagatgatgaat-tttatgggtttgatgatg |
13324513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University