View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14192_high_5 (Length: 245)
Name: NF14192_high_5
Description: NF14192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14192_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 10 - 240
Target Start/End: Complemental strand, 5582390 - 5582164
Alignment:
| Q |
10 |
attattctattttccgtgttgtggtgttcgtttgatttatattaaaaaatcgactcaattacagattcaattagnnnnnnnnnngtttgtttgaagaata |
109 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||| |||||||||||||||||||||| |||||||||||||||| ||| ||| ||||||| |
|
|
| T |
5582390 |
attattttattttccgtgttgcggtgatcgtttagtttatattaaaaaatcgactcatttacagattcaattagctattt-----ttttttttaagaata |
5582296 |
T |
 |
| Q |
110 |
cagactcaattagttgagattcaacattgatatttatagaa-tatttcaataacattaatgcaaatgaaactgatatttatagaaatgttttaccaacat |
208 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
5582295 |
cagattcaattagttgagattcaacattgatatttatagaaatattttaataacattaatgcaaatgaaactgatatttatagaaatattttaacaacat |
5582196 |
T |
 |
| Q |
209 |
taatgcaaatgaaacaccgttactttgtttct |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
5582195 |
taatgcaaatgaaataccgttactttgtttct |
5582164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University