View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14192_low_6 (Length: 203)
Name: NF14192_low_6
Description: NF14192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14192_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 34549588 - 34549766
Alignment:
| Q |
1 |
ccctaactaataacttcgttacatcagttgagaaatttaaccacattaactaacccttgtgatagctatagtgatgattaacgcacttgtttcatataca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
34549588 |
ccctaactaataacttcgttacatcagttgagaaatttaaccacattaactaacccttgtgatagctataatgatgattaacgca-ttgtttcatataca |
34549686 |
T |
 |
| Q |
101 |
ttgatggatatccccacccaacttaattgatggttccttcgcagaaaagaccttgagtttggtaggtatggaatcaaagc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34549687 |
ttgatggatatccccacccaacttaattgatggttccttcgcagaaaacaccttgagtttggtaggtatggaatcaaagc |
34549766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University