View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14192_low_6 (Length: 203)

Name: NF14192_low_6
Description: NF14192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14192_low_6
NF14192_low_6
[»] chr3 (1 HSPs)
chr3 (1-180)||(34549588-34549766)


Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 34549588 - 34549766
Alignment:
1 ccctaactaataacttcgttacatcagttgagaaatttaaccacattaactaacccttgtgatagctatagtgatgattaacgcacttgtttcatataca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||    
34549588 ccctaactaataacttcgttacatcagttgagaaatttaaccacattaactaacccttgtgatagctataatgatgattaacgca-ttgtttcatataca 34549686  T
101 ttgatggatatccccacccaacttaattgatggttccttcgcagaaaagaccttgagtttggtaggtatggaatcaaagc 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
34549687 ttgatggatatccccacccaacttaattgatggttccttcgcagaaaacaccttgagtttggtaggtatggaatcaaagc 34549766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University