View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14193_high_2 (Length: 488)
Name: NF14193_high_2
Description: NF14193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14193_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 200 - 477
Target Start/End: Original strand, 41705459 - 41705736
Alignment:
| Q |
200 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705459 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
41705558 |
T |
 |
| Q |
300 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705559 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
41705658 |
T |
 |
| Q |
400 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaaccaaagactgcggttcat |
477 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705659 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaaccaaagactgcggttcat |
41705736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 41705260 - 41705399
Alignment:
| Q |
1 |
cactcttcatttcacattcttcatctcaaatgctactattacctctaacacactcactctccataatagaattcaacacaacccaccacctccttaaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705260 |
cactcttcatttcacattcttcatctcaaatgctactattacctctaacacactcactctccatgatagaattcaacacaacccaccacctccttaaatc |
41705359 |
T |
 |
| Q |
101 |
cacctcaactcactcattatcacgcttccaccgccataaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705360 |
cacctcaactcactcattatcacgcttccaccgccataaa |
41705399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 222 - 302
Target Start/End: Complemental strand, 3744418 - 3744338
Alignment:
| Q |
222 |
caacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaa |
302 |
Q |
| |
|
|||| |||||| ||||||||||||||||| || ||||||||||||||||| || |||| ||| | ||||| ||||||||| |
|
|
| T |
3744418 |
caactcataacactctacatggacacaggtagcgaccttgtttggttcccttgttcacctttcgaatgcattctctgtgaa |
3744338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University