View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14194_high_11 (Length: 385)
Name: NF14194_high_11
Description: NF14194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14194_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 38 - 164
Target Start/End: Complemental strand, 48332944 - 48332818
Alignment:
| Q |
38 |
cctgagtctccgtgaacttatatagtttgtagggataatttgtaatatatttacttaaagaaaaagttttttattttctttaaaaggagtgcacaaaagt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48332944 |
cctgagtctccgtgaacttatatagtttgtagggataatttgtaatatatttacttaaagaaaaagttttttattttctttaaaaggagtgcacaaaagt |
48332845 |
T |
 |
| Q |
138 |
tttatccatgtcatgatatgcatcgcc |
164 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48332844 |
tttatccatgtcatgatatgcatcgcc |
48332818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 164 - 192
Target Start/End: Complemental strand, 48332744 - 48332716
Alignment:
| Q |
164 |
catgtgtaaactgattttacatcaacaac |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48332744 |
catgtgtaaactgattttacatcaacaac |
48332716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University