View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14194_low_17 (Length: 309)
Name: NF14194_low_17
Description: NF14194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14194_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 50046966 - 50046880
Alignment:
| Q |
14 |
aagtttgagcaaatatccctatatcctagtcaactttcagcttaactgcattcaaatctctactatggttaccattcttatattctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50046966 |
aagtttgagcaaatatccctatatcctagtcaactttcagcttaactgcattcaaatctctactatggttaccattcttatattctg |
50046880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 133 - 195
Target Start/End: Complemental strand, 50046846 - 50046784
Alignment:
| Q |
133 |
gaaattattgccgtgaaattctttcataacttttcttctactttaagctcatatggttacctt |
195 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50046846 |
gaaattattgccgtgaaattcttccataacttttcttctactttaagctcatatggttacctt |
50046784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University