View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14194_low_27 (Length: 237)
Name: NF14194_low_27
Description: NF14194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14194_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 39410496 - 39410716
Alignment:
| Q |
1 |
cagatttgctaaatgtccaatctccttcgaaatttgagtatataacattataact-gtcttttcttttactttattgctcacaatttctttgctccgcct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| ||||||||||||||||| | |
|
|
| T |
39410496 |
cagatttgctaaatgtccaatctccttcgaaatttgagtatataacattataacttgtcttttcttttactctatcgctcgcaatttctttgctccgctt |
39410595 |
T |
 |
| Q |
100 |
taacgggtgaagagaaccatcggttcaaagttgtggcagctctgcgattagcaaatgaatcgtcaccgc-----nnnnnnntatagagtttcattaccac |
194 |
Q |
| |
|
| ||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||| ||||| || | ||||||||| ||||||| |
|
|
| T |
39410596 |
tgacgggtgaaaaggaccatcggttcaaagttgtggcagctccgcgattagcaaatgaattgtcactgcaaaaaaaatatatctagagtttccttaccac |
39410695 |
T |
 |
| Q |
195 |
attctcctaattcaaacacta |
215 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39410696 |
attctcctaattcaaacacta |
39410716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University