View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14195_high_6 (Length: 440)
Name: NF14195_high_6
Description: NF14195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14195_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 2660978 - 2661175
Alignment:
| Q |
1 |
ataatgttgatgaggatttgaaagagcaggatgatggtgaagataggcctggtttagggttaggttttgggtcggctagtgtatcggggtctggtctagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2660978 |
ataatgttgatgaggatttgaaagagcaggatgatggtgaagataggcctggttttgggttaggttttgggtcggctagtgtatcggggtctggtctagg |
2661077 |
T |
|
| Q |
101 |
atttaattctggtcgtggtgtgaatggttcagataggaatgatgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661078 |
atttaattctggtcgtggtgtgaatggttcagataggaatgatgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg |
2661175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 273 - 410
Target Start/End: Original strand, 2661253 - 2661390
Alignment:
| Q |
273 |
ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttata |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661253 |
ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacaaagggaattggaatgaagctgcttgagaagatgggttata |
2661352 |
T |
|
| Q |
373 |
aagggggtggtcttgggaagaatgagcagggtatttta |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661353 |
aagggggtggtcttgggaagaatgagcagggtatttta |
2661390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 8e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 281 - 406
Target Start/End: Original strand, 25951995 - 25952117
Alignment:
| Q |
281 |
gggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggt |
380 |
Q |
| |
|
|||| ||||||||||||| || || ||||||||||||||| ||||| ||| | ||||| |||||||||||| | ||||| |||||||||||||| ||| |
|
|
| T |
25951995 |
gggtctaggtcaggagggatcagttgatgttgggaaattcaagagttata---acggaatgggaatgaagctgatggagaaaatgggttataaaggaggt |
25952091 |
T |
|
| Q |
381 |
ggtcttgggaagaatgagcagggtat |
406 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25952092 |
ggtcttgggaagaatgagcagggtat |
25952117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 286 - 406
Target Start/End: Original strand, 25945404 - 25945521
Alignment:
| Q |
286 |
taggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggtggtct |
385 |
Q |
| |
|
||||||| |||| || ||||||||||||||||| |||| | ||| || ||||| |||||||||||| | ||||| |||||||||||||| |||||||| |
|
|
| T |
25945404 |
taggtcacgaggaatcagtggatgttgggaaattggagaat--tac-aacggaatgggaatgaagctgatggagaaaatgggttataaaggaggtggtct |
25945500 |
T |
|
| Q |
386 |
tgggaagaatgagcagggtat |
406 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25945501 |
tgggaagaatgagcagggtat |
25945521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University