View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14196_high_22 (Length: 354)
Name: NF14196_high_22
Description: NF14196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14196_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 304; Significance: 1e-171; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 22 - 349
Target Start/End: Complemental strand, 33519693 - 33519366
Alignment:
| Q |
22 |
tacctgatcaccaattggaatgccatctctcattcctgttgtttgcaaaaagccttttattggacgagctgcttcgagagggcaagttgagaggtagcat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33519693 |
tacctgatcaccaattggaatgccatctctcatcccagttgtttgcaaaaagccttttattggacgagctgcttcgagagggcaagtagagaggtagcaa |
33519594 |
T |
 |
| Q |
122 |
tccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctaggcaactggctcc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519593 |
tccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctaggcaactggctcc |
33519494 |
T |
 |
| Q |
222 |
caagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagttactaagaaagaacgata |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519493 |
caagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagttactaagaaagaacgata |
33519394 |
T |
 |
| Q |
322 |
tagccattttcttttaattcatctcact |
349 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
33519393 |
gagccattttcttttaattcatgtcact |
33519366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 22 - 280
Target Start/End: Original strand, 33496263 - 33496521
Alignment:
| Q |
22 |
tacctgatcaccaattggaatgccatctctcattcctgttgtttgcaaaaagccttttattggacgagctgcttcgagagggcaagttgagaggtagcat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||| || ||||||| |||||||||||||||| ||||| || ||||| ||||||||||| |
|
|
| T |
33496263 |
tacctgatcaccaattggaatgccatctctcatcccagttgtttccagaaagcctcttattggacgagctgcctcgagtggacaagtagagaggtagcaa |
33496362 |
T |
 |
| Q |
122 |
tccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctaggcaactggctcc |
221 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||| | | |||||| || ||| |
|
|
| T |
33496363 |
tccttggcatagagagctccatagttattgatgccaatgaagtccaggctgcctcttaggagactcttctccttcgtagagatctttggcaaccggttcc |
33496462 |
T |
 |
| Q |
222 |
caagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaacctt |
280 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33496463 |
caagaatagagcgcatctcagcagggtactcaccaaaaactaggggatctagtaacctt |
33496521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University