View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14196_high_29 (Length: 270)
Name: NF14196_high_29
Description: NF14196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14196_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 44989217 - 44989421
Alignment:
| Q |
19 |
atcacttttcctaaaaatattgacactaataatgctagaaagaggtaacaaggagcatatggtggctgcaaaagaaataaaataaaatagatggatgtta |
118 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44989217 |
atcagttttcctaaaaatattgacatcaataatgctagaaagaggtaacaaggagcatatggtggctgcaaaagaaataaaataaaatagatgcatgtta |
44989316 |
T |
|
| Q |
119 |
ataaaacaattgtttgttcagcatatttccacatttcagacagcactttcccatctaagcatattatgtgttctctccaacccatcaatcttattattta |
218 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44989317 |
ataaaacaa----ttgttcagtatatttccacatttcagacagcactttcccatctaagcatattatgtgttctctccaacccatcaatcttattattta |
44989412 |
T |
|
| Q |
219 |
cactaaatt |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
44989413 |
cactaaatt |
44989421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 220 - 264
Target Start/End: Original strand, 44989933 - 44989977
Alignment:
| Q |
220 |
actaaattgaagattgttgctcttaataagaattattttcttgga |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44989933 |
actaaattgaagattgttgctcttaataagaattatttgcttgga |
44989977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University