View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14196_high_32 (Length: 250)
Name: NF14196_high_32
Description: NF14196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14196_high_32 |
 | |
|
| [»] scaffold0019 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 3565997 - 3565757
Alignment:
| Q |
1 |
tcccatgcaagattttcaagcatggacagatacttatgatttattacatttaccaacaaagggcgcgctttttacatggaaaaatggaagagagggacga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
3565997 |
tcccatgcaagattttcaagcatggacagatacttatgatttattacatttaccaacaaagggcgcgctttttacatggaaaaatggaagatagggatga |
3565898 |
T |
|
| Q |
101 |
agattcactcaaaggagactggacaggtctatttgcaatcaagattggttagatgcatgtagcacaacatctcgttcaactttaataaggctcacctctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3565897 |
agattcactcaaaggagactggacaggtctatttgcaatcaagattggttagatgcatgtagcacaacatctcgttcaactttaataaggctcacctctg |
3565798 |
T |
|
| Q |
201 |
accactatcatccccttcttctggaatttaaaacaacggag |
241 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3565797 |
agcactatcatccccttcttctggaatttaaaacaacggag |
3565757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 140075 - 139834
Alignment:
| Q |
1 |
tcccatgcaagattttcaagcatggacagatacttatgatttattacatttaccaacaaagggcgcgctttttacatggaaaaatggaagagagggacga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
140075 |
tcccatgcaagattttcaagcatggacagatacttatgatttattacatttaccaacaaagggcgcgctttttacatggaaaaatggaagaaagggaaga |
139976 |
T |
|
| Q |
101 |
agattcactcaaaggagactggacaggtctatttgcaatcaagattggttagatgcatgtagcacaacatctcgttcaactttaataaggctcacctctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
139975 |
agattcactcaaaggagactggacaggtctatttgcaatcaagattggttagatgcatgtagcacaacatcttgttcaactttaataaggctcacctctg |
139876 |
T |
|
| Q |
201 |
accactatcatccccttcttctggaatttaaaacaacggaggttc |
245 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
139875 |
accact---atccccttcttctggaatttaaaacaacagaggttc |
139834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University