View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14196_high_37 (Length: 205)
Name: NF14196_high_37
Description: NF14196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14196_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 34594081 - 34593888
Alignment:
| Q |
1 |
tataaaaattggtttgtcattgatatgctgtgattttgcaactgggttgttttttataaagtttttcttggtaggttaaaagggaaatgccatttgccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34594081 |
tataaaaattggtttgtcattgatatgctgtgattttgcaactgggttgttttttataaagtttttcttggtaggttaaaagggaaatgccatttgccac |
34593982 |
T |
 |
| Q |
101 |
gaaatatggattcagggggaaacacaaataactcacacatgaccttgtttttcaccaaatgac-nnnnnnnatcatgtatttattgataatatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34593981 |
gaaatatggattcagggggaaacacaaataacacacacatgaccttgttttccaccaaatgacttttttttatcatgtatttattgataatatt |
34593888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University