View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14196_high_37 (Length: 205)

Name: NF14196_high_37
Description: NF14196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14196_high_37
NF14196_high_37
[»] chr5 (1 HSPs)
chr5 (1-193)||(34593888-34594081)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 34594081 - 34593888
Alignment:
1 tataaaaattggtttgtcattgatatgctgtgattttgcaactgggttgttttttataaagtttttcttggtaggttaaaagggaaatgccatttgccac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34594081 tataaaaattggtttgtcattgatatgctgtgattttgcaactgggttgttttttataaagtttttcttggtaggttaaaagggaaatgccatttgccac 34593982  T
101 gaaatatggattcagggggaaacacaaataactcacacatgaccttgtttttcaccaaatgac-nnnnnnnatcatgtatttattgataatatt 193  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||        |||||||||||||||||||||||    
34593981 gaaatatggattcagggggaaacacaaataacacacacatgaccttgttttccaccaaatgacttttttttatcatgtatttattgataatatt 34593888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University