View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14196_low_26 (Length: 341)
Name: NF14196_low_26
Description: NF14196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14196_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 322
Target Start/End: Complemental strand, 37863459 - 37863146
Alignment:
| Q |
11 |
gaagaatatggtggcaaattaatgctaggtactactcctcttttggtacatgccattggtttcaattcaatattcttgtgtcatttaaatgttcactann |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863459 |
gaagaaaatggtggcaaattaatgctaggtactactcctcttttggtacatgccattggtttcaattcaatattcttgtgtcatttaaatgttcactatt |
37863360 |
T |
|
| Q |
111 |
nnnnnnnnnnncaattcaggttcgcatgaaaaacattggattactagaaaataatcattatgattatctcgaaaataaattactagagttgttgttgttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37863359 |
ttttgttttttcaattcaggttcgcatgaaaaacattggattactagaaaataatcattatgattatctcgaaaataaattactagagttgttgt---tg |
37863263 |
T |
|
| Q |
211 |
ttttatgtttggaagcaatttgcaattgcaaccttttaaatca-----ggtttggttggttggaacggaattattttattgtttcgaactaaaatatatt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863262 |
ttttatgtttggaagcaatttgcaattgcaaccttttaaatcaggtttggtttggttggttggaacggaattattttattgtttcgaactaaaatatatt |
37863163 |
T |
|
| Q |
306 |
ttgtctctaaatccttg |
322 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37863162 |
ttgtctctaaatccttg |
37863146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University