View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14196_low_29 (Length: 328)
Name: NF14196_low_29
Description: NF14196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14196_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 3332239 - 3331950
Alignment:
| Q |
1 |
caaacgtgacactaaggcaaccggcttctcctggggctgttgttacacttcatggaaggttcgagattctttcgctggctggatcgtttcttccaccacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332239 |
caaacgtgacactaaggcaaccggcttctcctggagctgttgttacacttcatggaaggttcgagattctttcgctggctggatcgtttcttccaccacc |
3332140 |
T |
|
| Q |
101 |
tgctccgcccgctgcttctggtttgaccatatatttagcgggcggacaagggcaggttgttggtggaagtgttgttggtgctttgattgcttctggacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332139 |
tgctccgcccgctgcttctggtttgaccatatatttagcgggcggacaagggcaggttgttggtggaagtgttgttggtgctttgattgcttctggacct |
3332040 |
T |
|
| Q |
201 |
gttgttattatgtctgcttcttttagtaacgctgcttatgagagacttcctttggaagaagatgatggttcttctattcaacaacttcaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3332039 |
gttgttattatgtctgcttcttttagtaacgctgcttatgagagacttcctttggaagatgatgatggttcttctattcaacaacttcaa |
3331950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 205
Target Start/End: Original strand, 39959944 - 39960017
Alignment:
| Q |
132 |
tatttagcgggcggacaagggcaggttgttggtggaagtgttgttggtgctttgattgcttctggacctgttgt |
205 |
Q |
| |
|
||||||||||| | ||||| || |||||||| || ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
39959944 |
tatttagcgggtgctcaaggacaagttgttggaggtgctgtagttggtgctttgattgcttcaggacctgttgt |
39960017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 16578946 - 16579014
Alignment:
| Q |
135 |
ttagcgggcggacaagggcaggttgttggtggaagtgttgttggtgctttgattgcttctggacctgtt |
203 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
16578946 |
ttagccggtggacaagggcaagttgttggtggaagtgttgttggacctttgattgctgctggacctgtt |
16579014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University