View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14196_low_33 (Length: 302)
Name: NF14196_low_33
Description: NF14196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14196_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 292
Target Start/End: Original strand, 34594201 - 34594486
Alignment:
| Q |
7 |
acacataactttcctaaagaaaaatgaatctttcnnnnnnnnttgatcataccaaggaagattctgatgcagtctttggcctcaactccagcatctacaa |
106 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
34594201 |
acacaaaacttcactaaagaaaaatgaatctttcaaaaaaa-ttgatcataccaaggaagattctgatgcagtctttggcttcaaccccagcatctacaa |
34594299 |
T |
|
| Q |
107 |
aacgcaatgaaaa-tatcgtataaatcacagcaaaatgacgaaacaaattcnnnnnnnnntgagtaaaaatataaagaaaactcgcctatgccggaaaat |
205 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34594300 |
aacgcaatgaaaaatatcgtataaatcacagcaaaatgacgaaacaaattcaacaaaaaatgagtaaaaatataaagaaaactcgcctatgccggaaaat |
34594399 |
T |
|
| Q |
206 |
ccaacacggcgtttcttcttggtttcatcgttgggatctgatttcaaagcgtgcttctgcttctgacccatttctttcggttctgtg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34594400 |
ccaacacggcgtttcttcttggtttcatcgttgggatctgatttcaaagcgtgcttctgcttctgacccatttctttcggttctgtg |
34594486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University