View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14197_high_20 (Length: 234)
Name: NF14197_high_20
Description: NF14197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14197_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 19 - 182
Target Start/End: Original strand, 47038368 - 47038531
Alignment:
| Q |
19 |
cgtaggacctcttaaatagaatacggcggtgtcgtaggcacgagcagcagctaccggagtgatgtaagaacctaaccatattcttgatcttttatttggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47038368 |
cgtaggacctcttaaatagaatacggcggtgtcgtaggcacgagcagcagctaccggagtgatgtaagaacctaaccatattcttgatcttttatttggt |
47038467 |
T |
 |
| Q |
119 |
tctcttatttctgctacccacttaccccactttctcttccttattcctctgtatggtttctcta |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47038468 |
tctcttatttctgctacccacttaccccactttctcttccttattcctctgtatggtttctcta |
47038531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 80 - 178
Target Start/End: Complemental strand, 5681578 - 5681480
Alignment:
| Q |
80 |
atgtaagaacctaaccatattcttgatcttttatttggttctcttatttctgctacccacttaccccactttctcttccttattcctctgtatggtttc |
178 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||| || ||||| ||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
5681578 |
atgtaagaacctaaccaaattcttgatcttttgtttggttctctaatctctgccacccacttaccccactttctcatccttattcctctatatggtttc |
5681480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 83 - 138
Target Start/End: Complemental strand, 24174098 - 24174043
Alignment:
| Q |
83 |
taagaacctaaccatattcttgatcttttatttggttctcttatttctgctaccca |
138 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||| |||||||||||| |||||| |
|
|
| T |
24174098 |
taagaacctaaccatattcttgttttttgatttggtgctcttatttctgataccca |
24174043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University