View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14197_low_10 (Length: 367)
Name: NF14197_low_10
Description: NF14197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14197_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 16 - 326
Target Start/End: Complemental strand, 51945143 - 51944833
Alignment:
| Q |
16 |
aatatccacattgaaccatctaaatcaaaataatcctcggcgtaacttagcttgtgttgctcaggcaaatcagttctcgtattatttttggtaaagatgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51945143 |
aatatccacattgaaccatctaaatcaaaataatcctcggcgtaacttagcttgtgttgctcaggcaaattagttctcgtattatttttggtaaagatgt |
51945044 |
T |
 |
| Q |
116 |
gaactctttaatgagactatgaaaattgtcaagtgacaaggcccacctaataacgatgcttcttagctgtgnnnnnnnccctccaaagaaacgaagcttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51945043 |
gaactctttaatgagactatgaaaattgtcaagtgacaaggcccacctaataacgatgcttcttagctgtgttttttttcctccaaagaaacgaagcttc |
51944944 |
T |
 |
| Q |
216 |
tatccttcagtcgtcatggaactattgttatgcacgtccttcacaacttttgaccatcaataaaacgcgctgtttggtggaagtgtcacttgcatgcatg |
315 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51944943 |
taaccttcagtcgtcatggaactattgttatgcacgtccttcacaacttttgaccatcaataaaacgcgctgtttggtggaagtgtcatttgcatgcatg |
51944844 |
T |
 |
| Q |
316 |
gggggatgaaa |
326 |
Q |
| |
|
| | ||||||| |
|
|
| T |
51944843 |
gagagatgaaa |
51944833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University