View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14197_low_13 (Length: 291)
Name: NF14197_low_13
Description: NF14197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14197_low_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 4 - 291
Target Start/End: Complemental strand, 41860087 - 41859800
Alignment:
| Q |
4 |
atgtcgaagaatatcattttcctatcaaagattttaaacctggtggattagaaaaatatattatataaaaagggataagtaattgtctatatttagggag |
103 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41860087 |
atgtctaagaatatcattttcgtatcaaagattttaaccatggtggattagaaaaatatattatataaaaagggataagtaattgtctatatttagggag |
41859988 |
T |
 |
| Q |
104 |
gaaattacttaccaagatgaaaacgttgagatctttatctgagatgttgactgcatcttgattctcatttctttggaactcaagcaagacatccaagaaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41859987 |
gaaattacttaccaagatgaaaacgttgagatctttatctgagatgttgactgcatcttgattctcatttctttggaactcaagcaagacatccaagaaa |
41859888 |
T |
 |
| Q |
204 |
tctcttgatttctcatcacgttccacttccaaatccaaacgctctttcacaaacgtggaagcaatttcaatagcttttcccatatccc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41859887 |
tctcttgatttctcatcacgttccacttccaaatccaaacgctctttcacaaacgtggaagcaatttcaatagcttttcccatatccc |
41859800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University