View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14197_low_16 (Length: 251)
Name: NF14197_low_16
Description: NF14197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14197_low_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 30218789 - 30219027
Alignment:
| Q |
13 |
ttatactgttgggtgattgtgatatgtttatggaaagcatgcggtattgccattttgctgaccttaggtgacatccctggtcgttgttaccaaccaatca |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30218789 |
ttatgctgttgggtgattgtgatatgtttatggaaagcatgcggtattgccattttgctgaccttaggtgacatccctggtcgttgttaccaaccaatca |
30218888 |
T |
 |
| Q |
113 |
gtccttttctaatcccttattttttgtacttttgagttactacaaataatcatcaattaggcaaatcctttagccactttaaaatattcaaatataaaca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30218889 |
gtccttttctaatcccttattttttgtacttttgagttactacaaataatcatcaattaggcaaatcctttagccactttaaaatattcaaatataaaca |
30218988 |
T |
 |
| Q |
213 |
aacattattatactatagaccatatatacgattccactc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30218989 |
aacattattatactatagaccatatatacgattccactc |
30219027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University