View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14197_low_19 (Length: 242)
Name: NF14197_low_19
Description: NF14197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14197_low_19 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 55 - 242
Target Start/End: Original strand, 4619169 - 4619356
Alignment:
| Q |
55 |
atcccatagtttggattatgatatttgaattggaaggaaattttctggttggtcacccaattttccttaggcgttactcgcaaatttgagcggggggtgt |
154 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4619169 |
atcccaaagtttggattatgatatttgaattggaaggaaattttctggttggtcacccaattttccttaggcgttactcgcaaatttgagtggggggtgt |
4619268 |
T |
|
| Q |
155 |
attagtatatatagttaatgcatgaagagattctttacaagctgtgtctcaaagtttcactccccctcgaaacataagtaatctcact |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
4619269 |
attagtatatatagttaatgcatgaagagattcttcacaagctgtgtctcaaagtttcactcccactcgaaacataagaaatctcact |
4619356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 9 - 66
Target Start/End: Original strand, 4619081 - 4619138
Alignment:
| Q |
9 |
agcacagggacacaaccccccaaaaaatattcaataaatattcgtgatcccatagttt |
66 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4619081 |
agcacagagacacaaccccccaaaaaatattcaataaatattcgtgatcccatagttt |
4619138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University