View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14198_high_18 (Length: 242)
Name: NF14198_high_18
Description: NF14198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14198_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 1586881 - 1586660
Alignment:
| Q |
5 |
aaccatatatagagaagaagaaataatgatagcaacgcgagattgattgtaaatccacagatgataaaatcttgttttggataaggatatttatttgaaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1586881 |
aaccatatatagagaagaagaaataatgatagcaacgcgagattgattgtaaatccacacatgatacaatcttgttttggataaggatatttatttgaaa |
1586782 |
T |
|
| Q |
105 |
aagttttggattggcaattagaaatgaatgtacgatgttaaggattacaaaactggaagagaggagatggagttcacgtgaggttgattgtgaaaggtag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1586781 |
aagttttggattggcaattagaaatgaatgtacgatgttaaggattacaaaactggaagagaggagatggagttcacgtgaggttgattgtgaaaggtag |
1586682 |
T |
|
| Q |
205 |
tggtcactgaccacactagttt |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1586681 |
tggtcactgaccacactagttt |
1586660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University