View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14198_low_12 (Length: 335)
Name: NF14198_low_12
Description: NF14198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14198_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 20 - 322
Target Start/End: Complemental strand, 33081926 - 33081624
Alignment:
| Q |
20 |
aaaacgccgacgcttcctctggtttacacgacttcctcgagcgcatgcgccaacccgccgccgccgatttcgtcaaagctatcaaaaggttccttccttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081926 |
aaaacgccgacgcttcctctggtttacacgacttcctcgagcgcatgcgccaacccgccgccgccgatttcgtcaaagctatcaaaaggttccttccttc |
33081827 |
T |
|
| Q |
120 |
ttcttttcaccatcttaatttcaatccgaaccctaatcaattcactgatgcattgcaataattataattttacagtttcatagtttcattttcaaatcat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
33081826 |
ttcttttcaccatcttaatttcaatccgaaccctaatcaattcactgatgcatagcaataattatgattttacagtttcatagtttcgttttcaaatcat |
33081727 |
T |
|
| Q |
220 |
ggacccgatcctgagagagacagtgatgccgtacaagactttcttgctaatatggaagctgctttcaaagctcatcccctttgggccggttgctctgatg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081726 |
ggacccgatcctgagagagacagtgatgccgtacaagactttcttgctaatatggaagctgctttcaaagctcatcccctttgggccggttgctctgatg |
33081627 |
T |
|
| Q |
320 |
atg |
322 |
Q |
| |
|
||| |
|
|
| T |
33081626 |
atg |
33081624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University