View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14198_low_19 (Length: 251)
Name: NF14198_low_19
Description: NF14198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14198_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 22594865 - 22594631
Alignment:
| Q |
1 |
cccttgcttttgttgcgatttcttaaaagctacaaaaccaaacttctacctagacgcagcaagcttgttgtgattttggcaaaacatgaggttcaaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22594865 |
cccttgcttttgttgcgatttcttaaaagctacaaaaccaaacttctacctagacgcagcaagcttgttgtgattttggcaaaacatgaggttcaaccaa |
22594766 |
T |
 |
| Q |
101 |
ttgtttgtcgcaatttcataaaagctacaaaaccaaacttcaacttggatgtgaaaagtttgatgtggttgtggtaacacatgaagttcaaccaactgtt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22594765 |
ttgttcgtcgcaatttcataaaagctacaaaaccaaacttcaacttggatgtgaaacgtttgatgtggttgtggtaacacatgaagttcaaccaactgtt |
22594666 |
T |
 |
| Q |
201 |
ggtatgctttaccaagatttaactggagcaaatcc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22594665 |
ggtatgctttaccaagatttaactggagcaaatcc |
22594631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University