View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1419_high_19 (Length: 251)
Name: NF1419_high_19
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1419_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 235
Target Start/End: Original strand, 30620370 - 30620598
Alignment:
| Q |
10 |
gcacagatgaacttgactgtgagccagtactcatagaaagtgatagtgtctgcacacgtgcaccactttcattgttgttattgttgttgttttctggt-- |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620370 |
gcacagatgaacttgactgtgagccagtactcatagaaagtgatagtgtctgcacacgtgcaccactttcattgttgttattgttgttgttttctggtgg |
30620469 |
T |
|
| Q |
108 |
-ggtggttggtttctgagccatgtttttatcatagataaacctatcgagttattgttacttgtgctaccatcaccaccgccacaggatgcttccggctga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620470 |
tggtggttggtttctgagccatgtttttatcatagataaacctattgagttattgttacttgtactaccatcaccaccgccacaggatgcttccggctga |
30620569 |
T |
|
| Q |
207 |
tgaggtggaaggtgtaatgaagagtatga |
235 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
30620570 |
tgaggtgggaggtgtaatgaagagtatga |
30620598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University