View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1419_high_2 (Length: 433)
Name: NF1419_high_2
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1419_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 10 - 416
Target Start/End: Original strand, 37005615 - 37006021
Alignment:
| Q |
10 |
agatgaagcaatccacaatttgctttttgtgttgggtttcaactcatatggtgggttttcaatttttcttccaaaattgatagatagcatagcgaacggt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37005615 |
agatgaagcaatccacaatttgctttttgtgttgggtttcaactcatatggtgggttttcaatttttcttccaaaattgatagatagcatagcgaacggt |
37005714 |
T |
|
| Q |
110 |
ccaaccggtttgcaagagaagttgaggaaggaagcgcgagagaaaggcggttctactcttgggtttgactcgttaaaagaattggaactaataaattcag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37005715 |
ccaaccggtttgcaagagaagttgaggaaggaagcgcgagagaaaggcggttctactcttgggtttgactcgttaaaagaattggaactaataaattcag |
37005814 |
T |
|
| Q |
210 |
tggtttatgaaacccttcgaatgaacccaccggttccacttcaatttggtcgagccagaaaagattttcagctcagctcatatgactccgcgttcaatgt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37005815 |
tggtttatgaaacccttcgaatgaacccaccggttccacttcaatttggtcgagccagaaaagattttcagctcagctcatatgactccgcgttcaatgt |
37005914 |
T |
|
| Q |
310 |
gaagaagggtgagttattatgtgggtttcagaagcttataatgagggacccggttgtgtttgatgaaccggaacaatttaaaccggaacggttcactaaa |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37005915 |
gaagaagggtgagttattatgtgggtttcagaagcttataatgagggacccggtcgtgtttgatgaaccggaacaatttaaaccggaacggttcactaaa |
37006014 |
T |
|
| Q |
410 |
gagaaag |
416 |
Q |
| |
|
||||||| |
|
|
| T |
37006015 |
gagaaag |
37006021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University