View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1419_high_24 (Length: 238)
Name: NF1419_high_24
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1419_high_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 106 - 238
Target Start/End: Complemental strand, 20365657 - 20365525
Alignment:
| Q |
106 |
gattcagatcatttgttgaaaatgttggtgtttggttcactttcattattttgcctctaaaccttcaatttcatccttaaactatcattagtttagttat |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
20365657 |
gattcggatcatttgttgaaaatgttggtgtttggttcactttcattattttgcctctaaaccttcaatttcgtccttaaactattattagtttagttat |
20365558 |
T |
 |
| Q |
206 |
gaattaaggagagtggtaatttagaagctaact |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20365557 |
gaattaaggagagtggtaatttagaagctaact |
20365525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University