View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1419_high_25 (Length: 226)

Name: NF1419_high_25
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1419_high_25
NF1419_high_25
[»] chr3 (1 HSPs)
chr3 (1-220)||(33160661-33160874)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 33160661 - 33160874
Alignment:
1 catgtttaacaccaacaccgacatgacattgacacaatgacacatatgaacacattcagtcactttcactttggtatctatatctatgtgtcgtgtccgg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||      ||||||||||||||||    
33160661 catgtttaacaccaacaccgacatgacattgacacaatgacacatatgaacacattgagtcactttcactttggtatc------tatgtgtcgtgtccgg 33160754  T
101 tgtttgtgttagtagaaaacctagaaacaaaacccaaatgaattagaaaagaaatttacatggcccaaactcctgctctaggcgaattccaacatagatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33160755 tgtttgtgttagtagaaaacctagaaacaaaacccaaatgaattagaaaagaaatttacatggcccaaactcctgctctaggcgaattccaacatagatg 33160854  T
201 acactgcagagattgatcac 220  Q
    ||||||||||||||||||||    
33160855 acactgcagagattgatcac 33160874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University