View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1419_high_26 (Length: 216)

Name: NF1419_high_26
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1419_high_26
NF1419_high_26
[»] chr5 (1 HSPs)
chr5 (1-216)||(15369511-15369724)
[»] chr8 (6 HSPs)
chr8 (178-216)||(9577723-9577761)
chr8 (178-216)||(13009789-13009827)
chr8 (178-216)||(13011029-13011067)
chr8 (178-216)||(13117873-13117911)
chr8 (178-216)||(13135609-13135647)
chr8 (178-216)||(18668981-18669019)
[»] chr7 (2 HSPs)
chr7 (178-216)||(41866262-41866300)
chr7 (178-216)||(28261754-28261792)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 15369724 - 15369511
Alignment:
1 tatacttaagctagtgataaatgtttgctcttttgacccctatttattatttatctcccaaaacgtttgtgtgggggtgggataagcaaggctctgaatg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||    
15369724 tatacttaagctagtgataaatgtttgctcttttgacccctatttattatttatctcccaaaacgtttctgtgggggtgggataagcaaggctcttaatg 15369625  T
101 atgaaatatgatcgaattcacatttatctgtatcaacaaaagaaagccgaacaattggtcnnnnnnngtgaaaaggctggcttcgcccaggttcgaactg 200  Q
    |||||||||||||||||| |||||  ||||||||||||||||||||| ||||||||||||       || ||  ||||||||||||||||| ||||||||    
15369624 atgaaatatgatcgaattaacatt--tctgtatcaacaaaagaaagcagaacaattggtcaaaaaaagtaaagtggctggcttcgcccaggctcgaactg 15369527  T
201 gggaccttcagtgtgt 216  Q
    ||||||||||||||||    
15369526 gggaccttcagtgtgt 15369511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 9577761 - 9577723
Alignment:
178 tggcttcgcccaggttcgaactggggaccttcagtgtgt 216  Q
    |||||||||||||||| ||||||||||||||||||||||    
9577761 tggcttcgcccaggtttgaactggggaccttcagtgtgt 9577723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 13009789 - 13009827
Alignment:
178 tggcttcgcccaggttcgaactggggaccttcagtgtgt 216  Q
    |||||||||||||| ||||||||||||||||||||||||    
13009789 tggcttcgcccaggctcgaactggggaccttcagtgtgt 13009827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 13011029 - 13011067
Alignment:
178 tggcttcgcccaggttcgaactggggaccttcagtgtgt 216  Q
    |||||||||||||||| ||||||||||||||||||||||    
13011029 tggcttcgcccaggtttgaactggggaccttcagtgtgt 13011067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 13117911 - 13117873
Alignment:
178 tggcttcgcccaggttcgaactggggaccttcagtgtgt 216  Q
    |||||||||||||| ||||||||||||||||||||||||    
13117911 tggcttcgcccaggctcgaactggggaccttcagtgtgt 13117873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 13135647 - 13135609
Alignment:
178 tggcttcgcccaggttcgaactggggaccttcagtgtgt 216  Q
    |||||||||||||| ||||||||||||||||||||||||    
13135647 tggcttcgcccaggctcgaactggggaccttcagtgtgt 13135609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 18668981 - 18669019
Alignment:
178 tggcttcgcccaggttcgaactggggaccttcagtgtgt 216  Q
    |||||||||||||| ||||||||||||||||||||||||    
18668981 tggcttcgcccaggctcgaactggggaccttcagtgtgt 18669019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 41866262 - 41866300
Alignment:
178 tggcttcgcccaggttcgaactggggaccttcagtgtgt 216  Q
    |||||||||||||| ||||||||||||||||||||||||    
41866262 tggcttcgcccaggctcgaactggggaccttcagtgtgt 41866300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 28261754 - 28261792
Alignment:
178 tggcttcgcccaggttcgaactggggaccttcagtgtgt 216  Q
    |||||||||||||| | ||||||||||||||||||||||    
28261754 tggcttcgcccaggctagaactggggaccttcagtgtgt 28261792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University