View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1419_low_18 (Length: 284)
Name: NF1419_low_18
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1419_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 7090651 - 7090468
Alignment:
| Q |
17 |
actgtcacatgacaacccatgctaaattattgtgttatgatatggtctgaaatataacacataaaatattattttt-aaatcataaaccaaattgattct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7090651 |
actgtcacatgacaacccatgctaaattattgtgttatgatatggtctgaaatataacacataaaatattattttttaaatcataaaccaaattgattct |
7090552 |
T |
 |
| Q |
116 |
tgctaccagaccagatattccttttctatagatagaagggcaaccccaaaaataaactatataaaattttgcatagtatattaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7090551 |
tgctaccagaccagatattccttttctatagatagaagggcaaccccaaaaataaactatataaaattttgcatagtatattaa |
7090468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 218 - 253
Target Start/End: Complemental strand, 7090481 - 7090446
Alignment:
| Q |
218 |
gcatagtatattaatttgttcatagtatatatgtcc |
253 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7090481 |
gcatagtatattaattttttcatagtatatatgtcc |
7090446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University