View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1419_low_20 (Length: 282)
Name: NF1419_low_20
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1419_low_20 |
 |  |
|
| [»] scaffold0392 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 54 - 263
Target Start/End: Original strand, 49114016 - 49114226
Alignment:
| Q |
54 |
aggtgctaggtagtaaagaatataattccgtgcatgtttgggagaacactagaatagacaaaatcaccgtgaatcactatgattttggcaaaagctacac |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49114016 |
aggtgctaggtagtaaagaatataattccgtgcatgtttgggagaacactagaatagacaaaatcaccgtgaatcactatgattttgggaaaagctacac |
49114115 |
T |
 |
| Q |
154 |
tttgtagcttcacaaaatcatggtggctcgccgtgatttttcaatcccttcactcatgcaaacatgtacttcctaattgagcttaatttatggatag-tt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49114116 |
tttgtagcttcacaaaatcatggtggctcgccgtgatttttcaatcccttcactcatgcaaacatgtacttcctaattgagcttaatttatggatagttt |
49114215 |
T |
 |
| Q |
253 |
ttggaattgtg |
263 |
Q |
| |
|
||||||||||| |
|
|
| T |
49114216 |
ttggaattgtg |
49114226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 136 - 201
Target Start/End: Complemental strand, 34716467 - 34716402
Alignment:
| Q |
136 |
ttttggcaaaagctacactttgtagcttcacaaaatcatggtggctcgccgtgatttttcaatccc |
201 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
34716467 |
ttttggcaaaagctaccctttgcagcttcacacaatcatggtggttcaccgtgatttttcaatccc |
34716402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 49113964 - 49113997
Alignment:
| Q |
1 |
caaatgcaaataattcaacagaggaaaacatgtg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49113964 |
caaatgcaaataattcaacagaggaaaacatgtg |
49113997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 135 - 173
Target Start/End: Original strand, 8472547 - 8472586
Alignment:
| Q |
135 |
attttggcaaaagctacactttgtagcttc-acaaaatca |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8472547 |
attttggcaaaagctacactttgtagcttcaacaaaatca |
8472586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 6277548 - 6277508
Alignment:
| Q |
154 |
tttgtagcttcacaaaatcatggtggctcgccgtgattttt |
194 |
Q |
| |
|
|||||||||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
6277548 |
tttgtagctttacaaaatcagggtggctcaccgtgattttt |
6277508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 142 - 182
Target Start/End: Complemental strand, 46685285 - 46685245
Alignment:
| Q |
142 |
caaaagctacactttgtagcttcacaaaatcatggtggctc |
182 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
46685285 |
caaaagctacactttgtagctttgcaaaatcacggtggctc |
46685245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 133 - 171
Target Start/End: Original strand, 13375274 - 13375312
Alignment:
| Q |
133 |
tgattttggcaaaagctacactttgtagcttcacaaaat |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13375274 |
tgattttggcaaaagctacactttgtagcttcacaaaat |
13375312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 111 - 199
Target Start/End: Complemental strand, 13314350 - 13314262
Alignment:
| Q |
111 |
acaaaatcaccgtgaatcactatgattttggcaaaagctacactttgtagcttcacaaaatcatggtggctcgccgtgatttttcaatc |
199 |
Q |
| |
|
||||||||| |||| |||| ||||| |||||||||||||||||| ||||||||| |||| | |||||||| |||||||||||||| |
|
|
| T |
13314350 |
acaaaatcaaagtgagtcaccatgatcctggcaaaagctacactttatagcttcaccaaattacggtggctcagtgtgatttttcaatc |
13314262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 133 - 199
Target Start/End: Complemental strand, 11774048 - 11773982
Alignment:
| Q |
133 |
tgattttggcaaaagctacactttgtagcttcacaaaatcatggtggctcgccgtgatttttcaatc |
199 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| |||||||| || | ||||||||||| |
|
|
| T |
11774048 |
tgattttggcaatagctacactctgtagcttcacaaaattgcggtggctcaccataatttttcaatc |
11773982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 110 - 173
Target Start/End: Original strand, 5548808 - 5548871
Alignment:
| Q |
110 |
gacaaaatcaccgtgaatcactatgattttggcaaaagctacactttgtagcttcacaaaatca |
173 |
Q |
| |
|
||||||||||| ||||||| | |||||||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
5548808 |
gacaaaatcacggtgaatcgccttgattttggctaaagctacacttttgagcttcccaaaatca |
5548871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 132 - 199
Target Start/End: Original strand, 11772363 - 11772430
Alignment:
| Q |
132 |
atgattttggcaaaagctacactttgtagcttcacaaaatcatggtggctcgccgtgatttttcaatc |
199 |
Q |
| |
|
||||||||||| | |||||||||||||| ||||||||||| | |||||||| | | ||||||||||| |
|
|
| T |
11772363 |
atgattttggcgatagctacactttgtaacttcacaaaattacggtggctcagcataatttttcaatc |
11772430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 199
Target Start/End: Complemental strand, 13331557 - 13331491
Alignment:
| Q |
133 |
tgattttggcaaaagctacactttgtagcttcacaaaatcatggtggctcgccgtgatttttcaatc |
199 |
Q |
| |
|
|||||||||| | |||||||||||| |||||||||| || | ||||||||| | | ||||||||||| |
|
|
| T |
13331557 |
tgattttggcgatagctacactttgaagcttcacaatattacggtggctcgacataatttttcaatc |
13331491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 193
Target Start/End: Original strand, 25048886 - 25048947
Alignment:
| Q |
132 |
atgattttggcaaaagctacactttgtagcttcacaaaatcatggtggctcgccgtgatttt |
193 |
Q |
| |
|
||||||||| |||||| |||||| ||||| |||||||||||| |||| || |||||||||| |
|
|
| T |
25048886 |
atgattttgacaaaagttacactctgtagtttcacaaaatcacggtgattcaccgtgatttt |
25048947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 135 - 199
Target Start/End: Complemental strand, 13342507 - 13342443
Alignment:
| Q |
135 |
attttggcaaaagctacactttgtagcttcacaaaatcatggtggctcgccgtgatttttcaatc |
199 |
Q |
| |
|
|||||||| | || ||||||||||||||||||||||| | ||||| ||| | | ||||||||||| |
|
|
| T |
13342507 |
attttggcgatagatacactttgtagcttcacaaaattacggtggttcggcataatttttcaatc |
13342443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 128 - 182
Target Start/End: Original strand, 48835856 - 48835910
Alignment:
| Q |
128 |
cactatgattttggcaaaagctacactttgtagcttcacaaaatcatggtggctc |
182 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||||||||||||||| |||||||| |
|
|
| T |
48835856 |
cactatgattttagcaaaagctaaactttatagcttcacaaaatcacggtggctc |
48835910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 191
Target Start/End: Original strand, 43049445 - 43049494
Alignment:
| Q |
143 |
aaaagctacactttgtagcttc-acaaaatcatggtggctcgccgtgatt |
191 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
43049445 |
aaaagctacactttgtagcttctgcaaaatcatggtgggtcgccgtgatt |
43049494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 173
Target Start/End: Original strand, 596324 - 596366
Alignment:
| Q |
132 |
atgattttggcaaaagctacactttgtagcttc-acaaaatca |
173 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
596324 |
atgattttggcaaaagctacactttgtggcttcgacaaaatca |
596366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 131 - 172
Target Start/End: Original strand, 14703019 - 14703060
Alignment:
| Q |
131 |
tatgattttggcaaaagctacactttgtagcttcacaaaatc |
172 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| |||| |
|
|
| T |
14703019 |
tatgattttgtcaaaaactacactttgtagcttcacataatc |
14703060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0392 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0392
Description:
Target: scaffold0392; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 133 - 173
Target Start/End: Complemental strand, 2094 - 2053
Alignment:
| Q |
133 |
tgattttggcaaaagctacactttgtagcttc-acaaaatca |
173 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
2094 |
tgattttcgcaaaagctacactttgtagcttcaacaaaatca |
2053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 178
Target Start/End: Original strand, 3643720 - 3643765
Alignment:
| Q |
134 |
gattttggcaaaagctacactttgtagcttc-acaaaatcatggtg |
178 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
3643720 |
gatttttgcaaaagctacactttgtagcttcaataaaatcatggtg |
3643765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 133 - 161
Target Start/End: Complemental strand, 10214093 - 10214065
Alignment:
| Q |
133 |
tgattttggcaaaagctacactttgtagc |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10214093 |
tgattttggcaaaagctacactttgtagc |
10214065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University